ncbitools stable port information

Package: ncbitools
Version: 20080302
Revision: 1
BuildDepends: fink (>= 0.32)
Source: ftp://ftp.ncbi.nlm.nih.gov/toolbox/ncbi_tools/old/%v/ncbi.tar.gz
SourceRename: %n-%v.tar.gz
NoSourceDirectory: true
Source2: mirror:sourceforge:fink/vector.Z
Source-MD5: f8de9d7264aed7de1d87d2185df2e07c
Source2-MD5: 331aa865cc6267d5b0b5e92e669ce5a2
PatchFile: %n.patch
PatchFile-MD5: 8f4193c40204ea72e840198198e4b7d6
PatchFile2: %n-x86_64.patch
PatchFile2-MD5: 52641c9deba945c98d46a77c3efbc76d
PatchScript: <<
patch -p1 < %{PatchFile}
if [[ "%m" == "x86_64" ]]; then patch -p1 < %{PatchFile2}; fi
# perl -pi -e 's/(FSLockRange|FSUnlockRange)/MF_\1/g' `grep -lri lockrange .`
<<
RuntimeVars: <<
BLASTDB: /data/blastdb
BLASTMAT: %p/share/%n/data
<<
UseMaxBuildJobs: false
CompileScript: <<
ncbi/make/makedis.csh
<<
InstallScript: <<
#!/bin/sh -ev
### install programs
install -d -m 755 %i/bin
## list generated from '/bin/ls -1 ncbi/build'.
export binaries="asn2ff asn2gb asn2idx asn2xml asndhuff asntool bl2bag.cgi bl2seq blast blastall blastall_old blastcl3 blastclust blastpgp cdscan checksub copymat debruijn demo_regexp demo_regexp_grep dosimple entrcmd errhdr fa2htgs fastacmd findspl formatdb formatrpsdb gene2xml getmesh getpub gil2bin idfetch impala indexpub makemat makeset megablast ncbisort nph-viewgif.cgi rpsblast seedtop seqtest tbl2asn test_regexp testcore testobj testval vecscreen wblast2.REAL wblast2_cs.REAL"
## these are only built on 32bit installs
export binaries_32bit="blast.REAL blast_cs.REAL ddv entrez2 Psequin psiblast.REAL psiblast_cs.REAL sbtedit udv"
if [[ "%m" != "x86_64" ]]; then export binaries="$binaries $binaries_32bit"; fi
for file in $binaries; do install -c -p -m 755 ncbi/build/$file %i/bin; done

### install manfiles
install -d -m 755 %i/share/man/man1
export manfiles="asn2all.1 asn2asn.1 asn2ff.1 asn2fsa.1 asn2gb.1 asn2idx.1 asn2xml.1 asndhuff.1 asntool.1 asnval.1 bl2seq.1 blast.1 blastall.1 blastall_old.1 blastcl3.1 blastclust.1 blastpgp.1 cdscan.1 checksub.1 cleanasn.1 copymat.1 debruijn.1 errhdr.1 fa2htgs.1 fastacmd.1 findspl.1 fmerge.1 formatdb.1 formatrpsdb.1 gbseqget.1 gene2xml.1 getmesh.1 getpub.1 gil2bin.1 idfetch.1 impala.1 indexpub.1 insdseqget.1 makemat.1 makeset.1 megablast.1 nps2gps.1 rpsblast.1 seedtop.1 sortbyquote.1 spidey.1 tbl2asn.1 trna2sap.1 trna2tbl.1 vecscreen.1"
export manfiles_32bit="ddv.1 entrez2.1 Psequin.1 sbtedit.1 udv.1"
if [[ "%m" != "x86_64" ]]; then export manfiles="$manfiles $manfiles_32bit"; fi
for file in $manfiles; do install -c -p -m 644 ncbi/doc/man/$file %i/share/man/man1; done

install -d -m 755 %i/include/%n-%v/connect
install -c -p -m 644 ncbi/include/*.h %i/include/%n-%v
install -c -p -m 644 ncbi/include/connect/*.h %i/include/%n-%v/connect
ln -s %n-%v %i/include/%n

### install static libraries
install -d -m 755 %i/lib
export libraries="blast blastapi blastcompadj ncbi ncbiCacc ncbiNacc ncbiacc ncbicdr ncbiid1 ncbimmdb ncbiobj ncbitool netblast netcli netentr regexp"
export libraries_32bit="ddvlib ncbicn3d ncbidesk ncbimla ncbitxc2 vibgif vibnet vibrant"
if [[ "%m" != "x86_64" ]]; then export libraries="$libraries $libraries_32bit"; fi
for file in $libraries; do install -c -p -m 644 ncbi/lib/lib$file.a %i/lib/lib$file-%v.a; ln -s lib$file-%v.a %i/lib/lib$file.a; done
for file in ncbithr; do install -c -p -m 644 ncbi/lib/$file.o %i/lib/$file-%v.o; ln -s $file-%v.o %i/lib/$file.o; done

### copy the doc directory
install -d -m 755 %i/share/doc/%n
cp -r ncbi/doc/* %i/share/doc/%n

cp -p ncbi/platform/darwin.ncbi.mk ncbi/platform/darwin.ncbi.mk.dist
cat ncbi/platform/darwin.ncbi.mk.dist | sed 's,/home/coremake/ncbi/bin,%p/bin,g' | sed 's,/home/coremake/ncbi/include,%p/include/ncbitools,g' | sed 's,/home/coremake/ncbi/lib,%p/lib,g' | sed 's,/home/coremake/ncbi/altlib,%p/altlib,g' > ncbi/platform/darwin.ncbi.mk
install -d -m 755 %i/lib/%n/%v
install -c -p -m 644 ncbi/platform/darwin.ncbi.mk %i/lib/%n/%v
install -d -m 755 %i/share/%n
ln -s %p/lib/%n/%v/darwin.ncbi.mk %i/share/%n/ncbi.mk
install -d -m 755 %i/share/%n/data
install -c -p -m 644 ncbi/data/* %i/share/%n/data
install -d -m 755 %i/share/%n/demo
uncompress -cf vector.Z > %i/share/%n/demo/vector
install -c -p -m 644 demo.fasta %i/share/%n/demo
%i/bin/formatdb -i %i/share/%n/demo/vector -p F
echo "#!/bin/sh" > %i/share/%n/demo/blastall.sh
echo "blastall -p blastn -d %p/share/%n/demo/vector -i %p/share/%n/demo/demo.fasta" >> %i/share/%n/demo/blastall.sh
chmod 755 %i/share/%n/demo/blastall.sh
<<
SplitOff: <<
Package: %N-dev
BuildDependsOnly: true
Files: <<
include
lib/*.a
lib/*.o
share/%N/ncbi.mk
lib/%N/%v/darwin.ncbi.mk
<<
DocFiles: LICENSE ncbi/README
<<
DocFiles: LICENSE ncbi/README ncbi/README.htm
License: Public Domain
Description: NCBI software development toolkit
DescDetail: <<
NCBI SOFTWARE DEVELOPMENT TOOLKIT
National Center for Biotechnology Information
Bldg 38A, NIH
8600 Rockville Pike
Bethesda, MD 20894

The NCBI Software Development Toolkit was developed for the production and
distribution of GenBank, Entrez, BLAST, and related services by NCBI. We make
it freely available to the public without restriction to facilitate the
use of NCBI by the scientific community. However, please understand that
while we feel we have done a high quality job, this is not commercial software.
The documentation lags considerably behind the software and we must make any
changes required by our data production needs. Nontheless, many people have
found it a useful and stable basis for a number of tools and applications.
<<
DescUsage: <<
To demonstrate %n, run:
%p/share/%n/demo/blastall.sh

You may manually download databases to
/data/blastdb from:
ftp://ftp.ncbi.nih.gov/blast/db/

If you want to use a location besides
/data/blastdb for your databases, then set
the environment variable BLASTDB.

For more information, see:
http://www.ncbi.nlm.nih.gov/BLAST/
<<
DescPort: <<
dmacks un-nested some function declarations, removed local versions
of functions now available in Carbon, and renamed some functions
that were added to Carbon in 10.4 but are not certain to be the same
as the local ones of the same name.

dmacks removed some extern'ed prototypes from some .h since all the
.c that use them already have their own prototype of it that is
static instead of extern (gcc4 requirement).
<<
Maintainer: Richard Graul
Homepage: http://www.ncbi.nlm.nih.gov/BLAST/

ncbitools stable port .patch

diff -Nurd -x'*~' ncbitools-2.2.6.orig/LICENSE ncbitools-2.2.6/LICENSE
--- ncbitools-2.2.6.orig/LICENSE 1969-12-31 19:00:00.000000000 -0500
+++ ncbitools-2.2.6/LICENSE 2005-12-29 00:24:13.000000000 -0500
@@ -0,0 +1,109 @@
+
+Introduction
+
+ The GenInfo Software Toolbox is a set of software and data exchange
+specifications that are used by NCBI to produce portable, modular software for
+molecular biology. We make this software and specifications available to the
+community for use in its own right, or as a foundation for building other
+tools with similar properties. All software produced by NCBI and here
+provided includes the following copyright notice:
+
+ **************************************************************************
+ * *
+ * National Center for Biotechnology Information *
+ * Bldg. 38A, NIH, 8600 Rockville Pike, Bethesda, MD 20894 *
+ * *
+ * COPYRIGHT NOTICE *
+ * *
+ * This software/database is "United States Government Work" under the *
+ * terms of the United States Copyright Act. It was written as part of *
+ * the author's official duties as a Government employee and thus cannot *
+ * be copyrighted. This software/database is freely available to the *
+ * public for use without a copyright notice. Restrictions cannot be *
+ * placed on its present or future use. *
+ * *
+ * Although all reasonable efforts have been taken to ensure the accuracy *
+ * and reliability of the software and data, the National Library of *
+ * Medicine (NLM) and the U.S. Government does not and cannot warrant the *
+ * performance or results that may be obtained by using this software or *
+ * data. The NLM and the U.S. Government disclaims all warranties as to *
+ * performance, merchantability or fitness for any particular purpose. *
+ * *
+ * In any work or product derived from this material, proper attribution *
+ * of the author as the source of the software or data would be *
+ * appreciated. *
+ * *
+ **************************************************************************
+
+ In those cases where software is made available from other sources,
+other restrictions may apply.
+
+ It is available by anonymous ftp from ftp.ncbi.nih.gov. In the "toolbox"
+directory you will find the following:
+
+Directory Structure
+
+ These files are available for anonymous ftp from "ftp.ncbi.nih.gov".
+The directory structure is as follows:
+
+ toolbox - top level toolbox directory
+ ncbi_tools - NCBI software development toolkit and ASN.1 specs
+ most current version (3.xx). FTP the toolkit from
+ this directory.
+ other_ncbi - various other tools made by ncbi
+ other_tools - a few ASN.1 tools not made by ncbi
+ vms_utils - VMS tools for untarring and uncompressing
+
+ncbi_tools
+
+ This is the NCBI portable software toolkit. A single compressed tar
+file contains all the code, ASN.1 specifications, and demo programs
+(including complete source code for Entrez). This file is:
+
+ncbi.tar.Z (Unix compressed tar file)
+ncbiZ.exe (DOS, Windows PKZIP file)
+ncbi.hqx (Mac self extracting archive)
+
+The contents of the files are the same except the UNIX version also includes
+the documentation. Documentation is available in the ncbi_tools/newdoc
+directory as MS Word file. A README in the files above explains installation.
+Hardcopy of the documentation and questions my be directed to
+toolbox@ncbi.nlm.nih.gov
+
+vms_utils
+
+ This contains a set of utilities and instructions for VMS users to
+untar and uncompress the files in the other directories. Get this first if
+you are on VMS and read the instructions. Kindly maintained by Will Gilbert
+of Whitehead Institute. Also contains other VMS utilities such as drivers
+for ISO9660 CDROMS.
+==========================================================================
+in other_tools directory:
+
+isode
+
+ This is a very large system of tools from ISO for use in prototyping
+OSI applications. It includes many large tools in one file, and 5 volumes of
+PostScript documentation in the other file. The documentation is good for
+learning about OSI. There is an ASN.1 compiler which will give you the
+flavor of what can be done with these tools. This is not a simple or terribly
+efficient system.
+
+
+osikit
+
+ This is a set of tools from NIST (formerly the Bureau of Standards)
+to assist development of OSI applications. It includes the free value tool,
+which can read and validate an ASN.1 specification and produce an encoder and
+decoder for both the print form and basic encoding rules form. We find it
+very useful for checking syntax on both specifications and data objects. The
+limitation is that in the print form, the tool can only accept VisibleStrings
+all on one line, and less than 200 chars in length.
+
+
+asn_pmp
+
+ A parser for ASN.1 print files written by Peter Karp. It parses print
+files into S expressions which makes a simple, flexible way to input data
+objects. It does no checking on syntax or content. See the README for more
+details.
diff -Nurd -x'*~' ncbitools-2.2.6.orig/demo.fasta ncbitools-2.2.6/demo.fasta
--- ncbitools-2.2.6.orig/demo.fasta 1969-12-31 19:00:00.000000000 -0500
+++ ncbitools-2.2.6/demo.fasta 2005-12-29 00:24:13.000000000 -0500
@@ -0,0 +1,4 @@
+>demo polylinker
+CAGGAAACAGCTATGACCATGATTACGAATTCGAAGCTTAAGGCCTCCATGGATCCCGGGTCGACGCGTA
+CGATATCGATGTCTAGATCTCCAGTACTAGTCTCGAGCTCTGCAGGGCCCGCGGTACCATGCATACTGGC
+CGTCGTTTTACAACGTCGTGACTGGGAAAAC
diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/api/salsap.h ncbitools-2.2.6/ncbi/api/salsap.h
--- ncbitools-2.2.6.orig/ncbi/api/salsap.h 1999-11-24 16:24:28.000000000 -0500
+++ ncbitools-2.2.6/ncbi/api/salsap.h 2006-03-30 00:55:23.000000000 -0500
@@ -96,7 +96,7 @@

NLM_EXTERN Pointer LIBCALL FindSeqAlignInSeqEntry (SeqEntryPtr sep, Uint1 choice);

-NLM_EXTERN SeqAlignPtr LIBCALL is_salp_in_sap (SeqAnnotPtr sap, Uint1 choice);
+//NLM_EXTERN SeqAlignPtr LIBCALL is_salp_in_sap (SeqAnnotPtr sap, Uint1 choice);

NLM_EXTERN Boolean LIBCALL is_dim1seqalign (SeqAlignPtr salp);

diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/api/salutil.h ncbitools-2.2.6/ncbi/api/salutil.h
--- ncbitools-2.2.6.orig/ncbi/api/salutil.h 1999-09-06 20:19:24.000000000 -0400
+++ ncbitools-2.2.6/ncbi/api/salutil.h 2006-03-30 00:56:29.000000000 -0500
@@ -119,7 +119,7 @@
NLM_EXTERN SeqIdPtr ValNodeSeqIdListDup (ValNodePtr id_list);
NLM_EXTERN CharPtr PNTR SeqIdListToCharArray (SeqIdPtr id_list, Int2 n);

-NLM_EXTERN SeqIdPtr SeqIdReplaceID (SeqIdPtr head, SeqIdPtr pre, SeqIdPtr sip, SeqIdPtr next);
+//NLM_EXTERN SeqIdPtr SeqIdReplaceID (SeqIdPtr head, SeqIdPtr pre, SeqIdPtr sip, SeqIdPtr next);
NLM_EXTERN BioseqPtr BioseqReplaceID (BioseqPtr bsp, SeqIdPtr newsip);
NLM_EXTERN SeqEntryPtr SeqEntryReplaceSeqID (SeqEntryPtr source_sep, SeqIdPtr sip);
/*********************************************************
diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/platform/darwin.ncbi.mk ncbitools-2.2.6/ncbi/platform/darwin.ncbi.mk
--- ncbitools-2.2.6.orig/ncbi/platform/darwin.ncbi.mk 2002-10-28 20:20:12.000000000 -0500
+++ ncbitools-2.2.6/ncbi/platform/darwin.ncbi.mk 2012-02-29 08:44:40.000000000 -0500
@@ -10,7 +10,7 @@
NCBI_AR=ar
NCBI_CC = cc -pipe
#NCBI_CFLAGS1 = -c -g -no-cpp-precomp
-NCBI_CFLAGS1 = -c -no-cpp-precomp -Wno-long-double
+NCBI_CFLAGS1 = -c -no-cpp-precomp
NCBI_LDFLAGS1 = -framework CoreServices -O2
NCBI_OPTFLAG = -O2
NCBI_BIN_MASTER = /home/coremake/ncbi/bin

ncbitools _unstable_ port .patch